Cixiidae and Derbidae (Hemiptera) putative vectors of phytoplasma of group 16 SrIV
Main Article Content
The phytoplasmas of the 16SrIV group cause lethal yellowing diseases (STAL) in palms worldwide. The Phytoplasma of coconut lethal yellowing (LY) has been known as 'Candidatus Phytoplasma palmae' (16SrIV-A). Like LY, many diseases caused by phytoplasma worldwide, their vectors have not been identified. The only incriminated phytoplasma vector of the LY is Haplaxius crudus (Hemiptera: Cixiidae). The objective of the present study was to determine the presence of 16SrIV phytoplasma in cixiids and derbids associated with palms (Adonidia merrillii y Cocos nucifera) positive to phytoplasmas. Captures of insects associated with these palms were made during the morning and afternoon. The presence of phytoplasma was determined by the real-time PCR using the TaqMan LY16S-ANYF (GCTAAGTCCCCACCATAACGT) and LY16S-ANYR (CGTGTCGTGAGAT-GTTAGGTTAAGT) primers; probe LY16S-ANYM (FAMCCCCTGTCGTTAATTG-NFQ). The presence of phytoplasma of the 16SrIV group was not detected in H. crudus although its presence was shown in H. skarphion (Hemiptera: Cixiidae), Oecleus snowi (Hemiptera: Cixiidae) and Persis foveatis (Hemiptera: Derbidae). These results suggest that these three species may be potential vectors of phytoplasma of group 16 SrIV in palms.
BARTLETT, C. R.; O'BRIEN, L. B.; WILSON, S. W. 2014. A review of the planthoppers (Hemiptera: Fulgoroidea) of the United States. Memoirs of the American Entomological Society 50: 1-298. https://ia801201.us.archive.org/28/items/memoirsofamerica5020amer/memoirsofamerica5020amer.pdf
BARTLETT, C. R.; PASSOS, E. M.; SILVA, F. G.; DINIZ, L. E. C.; DOLLET, M. 2018. A new species of Oecleus Stål (Hemiptera: Fulgoroidea: Cixiidae) from coconut in Brazil. Zootaxa 4472 (2): 358-364. https://doi.org/10.11646/zootaxa.4472.2.8
BERTACCINI, A.; DUDUK, B.; PALTRINIERI, S.; CONTALDO, N. 2014. Phytoplasmas and phytoplasma diseases: a severe threat to agriculture. American Journal of Plant Sciences 5 (12): 1763-1788. https://doi.org/10.4236/ajps.2014.512191
BILA, J.; MONDJANA, A.; SAMILS, B.; HÖGBERG, N.; WILSON, M. R.; SANTOS, L. 2017. First report of ‘Candidatus Phytoplasma palmicola’ detection in the planthopper Diostrombus mkurangai in Mozambique. Bulletin of Insectology 70 (1): 45-48. http://www.bulletinofinsectology.org/pdfarticles/vol70-2017-045-048bila.pdf
BOSCO D.; TEDESCHI R. 2013. Insect vector transmission assays. En: Dickinson, M.; Hodgetts, J. (Eds.). Phytoplasma. Methods in molecular biology (Methods and Protocols). Vol. 938. Humana Press, Totowa, NJ. 421 p. https://doi.org/10.1007/978-1-62703-089-2_7
BOSCO, D.; D’AMELIO, R.; WEINTRAUB, P. G.; JONES, P. 2009. Transmission specificity and competition of multiple phytoplasmas in the insect vector. pp. 293-308. En: Weintraub, P. G.; Jones, P. (Eds.). Phytoplasmas: genomes, plant hosts and vectors. CABI. Wallingford, Reino Unido. 352 p. https://doi.org/10.1079/9781845935306.0293
BRESSAN, A.; CLAIR, D.; SÉMÉTEY, O.; BOUDON-PADIEU, E. 2006. Insect injection and artificial feeding bioassays to test the vector specificity of Flavescence dorée phytoplasma. Phytopathology 96 (7): 790-796. https://doi.org/10.1094/PHYTO-96-0790
BROWN, S. E.; BEEN, B. O.; McLAUGHLIN, W. A. 2006. Detection and variability of the lethal yellowing group (16Sr IV) phytoplasmas in the Cedusa sp. (Hemiptera: Auchenorrhyncha: Derbidae) in Jamaica. Annals of Applied Biology 149 (1): 53-62. https://doi.org/10.1111/j.1744-7348.2006.00072.x
BROWN, S. E.; BEEN, B. O.; McLAUGHLIN, W. A. 2007. The lethal yellowing (16SrIV) group of phytoplasmas. Pest Technology 1 (1): 61-69. http://www.globalsciencebooks.info/Online/GSBOnline/images/0706/PT_1(1)/PT_1(1)61-69o.pdf
CHRISTENSEN, N. M.; NYSKJOLD, H.; NICOLAISEN, M. 2013. Real-time PCR for universal phytoplasma detection and quantification. pp. 245-252. En: Dickinson M.; Hodgetts, J. (Eds.). Phytoplasma. Methods in molecular biology (Methods and Protocols). Vol. 938. Humana Press, Totowa, NJ. 421 p. https://doi.org/10.1007/978-1-62703-089-2_21
CÓRDOVA, I.; OROPEZA, C.; ALMEYDA, H.; HARRISON, N. A. 2000. First report of a phytoplasma-associated leaf yellowing syndrome of Palma Jipi plants in Southern Mexico. Plant Disease 84 (7): 807-807. https://doi.org/10.1094/PDIS.2000.84.7.807A
CÓRDOVA, I.; OROPEZA, C.; PUCH-HAU, C.; HARRISON, N.; COLLÍ-RODRÍGUEZ, A.; NARVÁEZ, M.; NIC-MATOS, G.; REYES, C.; SÁENZ, L. 2014. A real-time PCR assay for detection of coconut lethal yellowing phytoplasmas of group 16SrIV subgroups A, D and E found in the Americas. Journal of Plant Pathology 96 (2): 343-352. http://doi.org/10.4454/JPP.V96I2.031
DAVIS, R. E.; LEE, I. M. 1993. Cluster-specific polymerase chain reaction amplification of 16S rDNA sequences for detection and identification of Mycoplasmalike Organisms. Phytopathology 83 (9): 1008-1011. https://doi.org/10.1094/Phyto-83-1008
DERY, K. S.; MARIAU, D.; PHILIPPE, R. 1996. Auchenorrhyncha (Homoptera), suspected vectors of coconut lethal yellowing disease in Ghana. Plantations, Recherche, Développement 3 (5): 355-363.
DICKINSON, M.; TUFFEN, M.; HODGETTS, J. 2013. The Phytoplasmas: An introduction. En: Dickinson, M.; Hodgetts, J. (Eds.). Phytoplasma. Methods in molecular biology (Methods and Protocols). Vol. 938. Humana Press, Totowa, NJ. 421 p. https://doi.org/10.1007/978-1-62703-089-2_1
DOLLET, M.; LLAUGER, R.; FABRE, S.; JULIA, J. F.; GONZALEZ, C.; CUETO, J. R. 2010. Nymphocixia caribbea (Fennah) (Homoptera: Cixiidae) potential candidate as coconut lethal yellowing vector in the Carribean. En: COST Action FA0807. Current status and perspectives of phytoplasma disease research and management, Sitges, Espagne, 1-02 February 2010. Disponible en: https://agritrop.cirad.fr/555468/ [Fecha revisión: 31 julio 2018].
DOLLET, M.; MACOME, F.; VAZ, A.; FABRE, S. 2011. Phytoplasmas identical to coconut lethal yellowing phytoplasmas from Zambesia (Mozambique) found in a pentatomide bug in Cabo Delgado province. Bulletin of Insectology 64 (Supplement): S139-S140. Disponible en: https://agritrop.cirad.fr/562170/ [Fecha revisión: 6 agosto 2018].
EDEN-GREEN, S. 1979. Attempts to transmit lethal yellowing disease of coconuts [Cocos nucifera L.] in Jamaica by leaf hoppers (Homoptera: Cicadelloidea). Tropical Agriculture (Trinidad y Tobago) 56 (3): 185-192.
EDWIN, B. T.; MOHANKUMAR, C. 2007. Molecular identificación of Proutista moesta as the vector and the phylogenetic analysis of KWD in India. Indian Journal of Biotechnology 6: 560-563. http://nopr.niscair.res.in/bitstream/123456789/3086/1/IJBT%206%284%29%20560-563.pdf
GALETTO, L.; PEGORARO, M.; MARZACHÌ, C.; ROSSI, E.; LUCCHI, A.; BOSCO, D. 2019. Potential role of the alien planthopper Ricania speculum as vector of Flavescence dorée phytoplasma. European Journal of Plant Pathology 154 (4): 1103-1110. https://doi.org/10.1007/s10658-019-01731-0
HARRISON, N.; RICHARDSON, P.; TSAI, J. H.; EBBERT, M.; KRAMER, J. P. 1996. PCR assay for detection of the phytoplasma associated with maize bushy stunt disease. Plant Disease 80 (3): 263-269. https://doi.org/10.1094/PD-80-0263
HARRISON, N. A.; WOMACK, M.; CARPIO, M. L. 2002. Detection and characterization of a lethal yellowing (16SrIV) group phytoplasma in Canary Island date palms affected by lethal decline in Texas. Plant Disease 86 (6): 676-681. https://doi.org/10.1094/PDIS.2002.86.6.676
HARRISON, N.; HELMICK, E.; ELLIOTT, M. 2008. Lethal yellowing‐type diseases of palms associated with phytoplasmas newly identified in Florida, USA. Annals of Applied Biology 153 (1): 85-94. https://doi.org/10.1111/j.1744-7348.2008.00240.x
HOGENHOUT, S. A.; OSHIMA, K.; AMMAR, E. D.; KAKIZAWA, S.; KINGDOM, H. N.; NAMBA, S. 2008. Phytoplasmas: bacteria that manipulate plants and insects. Molecular Plant Pathology 9 (4): 403-423. https://doi.org/10.1111/j.1364-3703.2008.00472.x
HOWARD, F. W. 1986. Myndus crudus (Homoptera: Cixiidae), a vector of lethal yellowing of palms. pp. 117-129. En: Wilson, M. R.; Nault, L. R. (Eds.). Proceedings of 2nd International Workshop on Leafhoppers and Planthoppers of Economic Importance. Brigham Young University, Provo, Utah, EE. UU.
HOWARD, F. W. 2001. Sap-feeders on palms. pp. 109- 232. En: Howard, F. W.; Moore, D.; Giblin-Davis, R. M.; Abad, R. G. (Eds.). Insects on palms. CABI Publishing. Wallingford, Reino Unido, 403 p. https://doi.org/10.1079/9780851993263.0109
HOWARD, F. W.; NORRIS, R. C.; THOMAS, D. L. 1983. Evidence of transmission of palm lethal yellowing agent by a planthopper, Myndus crudus (Homoptera, Cixiidae). Tropical Agriculture 60 (3): 168-171.
JARAUSCH, W.; FUCHS, A.; JARAUSCH, B. 2010. Establishment of a quantitative real-time PCR assay for the specific quantification of ‘Ca. Phytoplasma prunorum’ in plants and insects. Julius-Kühn-Archiv 427: 392-394. https://ojs.openagrar.de/index.php/JKA/article/view/623
KRAMER, J. P. 1977. Taxonomic study of the planthopper genus Oecleus in the United States (Homoptera: Fulgoroidea: Cixiidae). Transactions of the American Entomological Society 103 (2): 379-449. Disponible en: https://www.jstor.org/stable/25078207 [Fecha revisión: 6 agosto 2018].
KRAMER, J. P. 1979. Taxonomic study of the planthopper genus Myndus in the Americas (Homoptera: Fulgoroidea: Cixiidae). Transactions of the American Entomological Society 105 (3): 301-389. https://www.jstor.org/stable/25078242
KWADJO, K. E.; BEUGRÉ, N. D. I.; DIETRICH, C. H.; THIERRY KODJO, A. T.; ATTA DIALLO, H.; YANKEY, N.; DERY, S.; WILSON, M.; KONAN KONAN, J. N.; CONTALDO, N.; PALTRINIERI, S.; BERTACCINI, A.; AROCHA ROSETE, Y. 2018. Identification of Nedotepa curta Dmitriev as a potential vector of the Côte d’Ivoire lethal yellowing phytoplasma in coconut palms sole or in mixed infection with a ‘Candidatus Phytoplasma asteris’-related strain. Crop Protection 110: 48-56. https://doi.org/10.1016/j.cropro.2017.12.015
LEE, I. M.; DAVIS, R. E.; GUNDERSEN-RINDAL, D. E. 2000. Phytoplasma: Phytopathogenic Mollicutes. Annual Reviews in Microbiology 54 (1): 221-255. https://doi.org/10.1146/annurev.micro.54.1.221
LIU, J.; GOPURENKO, D.; FLETCHER, M. J.; JOHNSON, A. C.; GURR, G. M. 2017. Phytoplasmas–The “Crouching Tiger” Threat of Australian Plant Pathology. Frontiers in Plant Science 26: 599. https://doi.org/10.3389/fpls.2017.00599
LU, H.; WILSON, B. A. L.; ASH, G. J.; WORUBA, S. B.; FLETCHER, M. J.; YOU, M.; YANG, G.; GURR, G. M. 2016. Determining putative vectors of the Bogia coconut syndrome phytoplasma using loop-mediated isothermal amplification of single-insect feeding media. Scientific Reports 6 (1): 35801. https://doi.org/10.1038/srep35801
MARTÍNEZ, R. T.; NARVÁEZ, M.; FABRE, S.; HARRISON, N.; OROPEZA, C.; DOLLET, M.; HICHEZ, E. 2008. Coconut lethal yellowing on the southern coast of the Dominican Republic is associated with a new 16SrIV group phytoplasma. Plant pathology 57 (2): 366-366. https://doi.org/10.1111/j.1365-3059.2007.01726.x
MPUNAMI, A.; TYMON, A.; JONES, P.; DICKINSON, M. J. 2001. Identification of potential vectors of the coconut lethal disease phytoplasma. Plant Pathology 49 (3): 355-361. https://doi.org/10.1046/j.1365-3059.2000.00460.x
MYRIE, W.; HARRISON, N.; DOLLET, M.; BEEN, B. 2007. Molecular detection and characterization of phytoplasmas associated with lethal yellowing disease of coconut palms in Jamaica. Bulletin of Insectology 60 (2): 159-160. http://www.bulletinofinsectology.org/pdfarticles/vol60-2007-159-160myrie.pdf
MYRIE, W.; OROPEZA, C.; SAENZ, L.; HARRISON, N.; ROCA, M. M.; CÓRDOVA, I.; KU, S.; DOUGLAS, L. 2011. Reliable improved molecular detection of coconut lethal yellowing phytoplasma and reduction of associated disease through field management strategies. Bulletin of Insectology 64: S203-S204. http://www.bulletinofinsectology.org/pdfarticles/vol64-2011-S203-S204myrie.pdf
NARVÁEZ, M.; VÁZQUEZ-EUÁN, R.; HARRISON, N. A.; NIC-MATOS, G.; JULIA, J. F.; DZIDO, J. L.; FABRE, S.; DOLLET, M.; OROPEZA, C. 2018. Presence of 16SrIV phytoplasmas of subgroups A, D and E in planthopper Haplaxius crudus Van Duzee insects in Yucatán, Mexico. 3 Biotech 8: 61. https://doi.org/10.1007/s13205-018-1094-5
POWELL, C. M.; HAIL, D.; POTOCNJAK, J.; HANSON, J. D.; HALBERT, S. H.; BEXTINE, B. R. 2015. Bacterial community composition of three candidate insect vectors of palm phytoplasma (Texas Phoenix Palm Decline and Lethal Yellowing). Current Microbiology 70: 240-245. https://doi.org/10.1007/s00284-014-0709-2
RASHIDI, M.; D'AMELIO, R.; GALETTO, L.; MARZACHÌ, C.; BOSCO, D. 2014. Interactive transmission of two phytoplasmas by the vector insect. Annals of Applied Biology 165 (3): 404-413. https://doi.org/10.1111/aab.12146
REINERT, J. A. 1977. Field biology and control of Haplaxius crudus on St. Augustinegrass and Christmas palm. Journal of Economic Entomology 70 (1): 54-56. https://doi.org/10.1093/jee/70.1.54
SFORZA, R.; BOURGOIN, T.; WILSON, S. W.; BOUDON-PADIEU, E. 1999. Field observations, laboratory rearing and descriptions of immatures of the planthopper Hyalesthes obsoletus (Hemiptera: Cixiidae). European Journal of Entomology 96 (4): 409-418. https://www.eje.cz/artkey/eje-199904-0015_Field_observations_laboratory_rearing_and_descriptions_of_immatures_of_the_planthopper_Hyalesthes_obsoletus_H.php
SMART, C. D.; SCHNEIDER, B.; BLOMQUIST, C. L.; GUERRA, L. J.; HARRISON, N. A.; AHRENS, U.; LORENZ, K. H.; SEEMÜLLER, E.; KIRKPATRICK, B. C. 1996. Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region. Applied and Environmental Microbiology 62 (8): 2988-2993. https://doi.org/10.1128/AEM.62.8.2988-2993.1996
THOMAS, D.; NORRIS, R. 1980. The use of electron microscopy for lethal yellowing diagnosis [Cocos nucifera]. Proceedings of the annual meeting of the Florida State Horticultural Society, EE. UU. 93: 196-199.
TSAI, J. H.; KIRSCH, O. H. 1978. Bionomics of Haplaxius crudus (Homoptera: Cixiidae). Environmental Entomology 7 (2): 305-308. https://doi.org/10.1093/ee/7.2.305
TSAI, J. H.; WOODIEL, N. L.; KIRSCH, O. H. 1976. Rearing tecniques for Haplaxius crudus (Homoptera: Cixiidae). Florida Entomologist 59 (1): 41-43. https://doi.org/10.2307/3493167
TYMON, A. M.; JONES, P.; HARRISON, N. A. 1997. Detection and differentiation of African coconut phytoplasmas: RFLP analysis of PCR-amplified 16S rDNA and DNA hybridisation. Annals of Applied Biology 131 (1): 91-102. https://doi.org/10.1111/j.1744-7348.1997.tb05398.x
TYMON, A. M.; JONES, P.; HARRISON, N. A. 1998. Phylogenetic relationships of coconut phytoplasmas and the development of specific oligonucleotide PCR primers. Annals of Applied Biology 132 (3): 437-452. https://doi.org/10.1111/j.1744-7348.1998.tb05220.x
VÁZQUEZ-EUÁN, R. C. 2010. Detección y caracterización de fitoplasmas del grupo del amarillamiento letal en diferentes especies de palmeras en Yucatán. Tesis de Doctorado en Ciencias y Biotecnología de Plantas. Centro de Investigación Científica de Yucatán. Mérida, Yucatán, México. 75 p. Disponible en: http://cicy.repositorioinstitucional.mx/jspui/handle/1003/596 [Fecha revisión: 6 agosto 2018].
VÁZQUEZ-EUÁN, R.; HARRISON, N.; NARVÁEZ, M.; OROPEZA, C. 2011. Occurrence of a 16SrIV group phytoplasma not previously associated with palm species in Yucatan, Mexico. Plant Disease 95 (3): 256-262. https://doi.org/10.1094/PDIS-02-10-0150
WEINTRAUB, P. G. 2007. Insect vectors of phytoplasmas and their control–an update. Bulletin of Insectology 60 (2): 169-173. http://www.bulletinofinsectology.org/pdfarticles/vol60-2007-169-173weintraub.pdf
WEINTRAUB, P. G.; BEANLAND, L. 2006. Insect vectors of phytoplasmas. Annual Review of Entomology 51: 91-111. https://doi.org/10.1146/annurev.ento.51.110104.151039
WILSON, S. W. 2005. Keys to the families of Fulgoromorpha with emphasis on planthoppers of potential economic importance in the southeastern United States (Hemiptera: Auchenorrhyncha). Florida Entomologist 88 (4): 464-481. https://doi.org/10.1653/0015-4040(2005)88[464:KTTFOF]2.0.CO;2
Downloads
Accepted 2020-07-15
Published 2020-07-15
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License.
Authors retain the copyright on their work and are responsible for the ideas expressed in them. Once a manuscript is approved for publication, authors are asked for a publication license for the term of legal protection, for all territories that allows the use, dissemination and disclosure of the same.