Cíxidos y dérbidos (Hemiptera) vectores putativos de fitoplasma del grupo 16Sr-IV
Barra lateral del artículo
Contenido principal del artículo
Los fitoplasmas del grupo 16SrIV causan enfermedades tipo amarillamiento letal (STAL) en palmas a nivel mundial. El fitoplasma del amarillamiento letal del cocotero (ALC) se conoce como ‘Candidatus Phytoplasma palmae’ (16SrIV-A). Al igual que en el ALC, muchas enfermedades causadas por fitoplasma a nivel mundial, sus vectores no han sido identificados. El único vector del fitoplasma del ALC incriminado es Haplaxius crudus (Hemiptera: Cixiidae). El objetivo del presente estudio fue determinar la presencia del fitoplasma 16SrIV en cíxiidos y dérbidos asociados a palmas (Adonidia merrillii y Cocos nucifera) positivas a fitoplasmas. Se realizaron capturas de insectos asociados a estas palmas durante la mañana y tarde. La presencia de fitoplasma fue determinada por PCR en tiempo real, empleando los cebadores TaqMan LY16S-ANYF (GCTAAGTCCCCACCATAACGT) y LY16S-ANYR (CGTGTCGTGAGAT-GTTAGGTTAAGT); sonda LY16S-ANYM (FAMCCCCTGTCGTTAATTG-NFQ). No se detectó la presencia de fitoplasma del grupo 16SrIV en H. crudus aunque sí se mostró su presencia en H. skarphion (Hemiptera: Cixiidae), Oecleus snowi (Hemiptera: Cixiidae) y Persis foveatis (Hemiptera: Derbidae). Estos resultados sugieren que estas tres especies pueden ser potenciales vectores del fitoplasma del grupo 16 SrIV en palmas.
BARTLETT, C. R.; O'BRIEN, L. B.; WILSON, S. W. 2014. A review of the planthoppers (Hemiptera: Fulgoroidea) of the United States. Memoirs of the American Entomological Society 50: 1-298. https://ia801201.us.archive.org/28/items/memoirsofamerica5020amer/memoirsofamerica5020amer.pdf
BARTLETT, C. R.; PASSOS, E. M.; SILVA, F. G.; DINIZ, L. E. C.; DOLLET, M. 2018. A new species of Oecleus Stål (Hemiptera: Fulgoroidea: Cixiidae) from coconut in Brazil. Zootaxa 4472 (2): 358-364. https://doi.org/10.11646/zootaxa.4472.2.8
BERTACCINI, A.; DUDUK, B.; PALTRINIERI, S.; CONTALDO, N. 2014. Phytoplasmas and phytoplasma diseases: a severe threat to agriculture. American Journal of Plant Sciences 5 (12): 1763-1788. https://doi.org/10.4236/ajps.2014.512191
BILA, J.; MONDJANA, A.; SAMILS, B.; HÖGBERG, N.; WILSON, M. R.; SANTOS, L. 2017. First report of ‘Candidatus Phytoplasma palmicola’ detection in the planthopper Diostrombus mkurangai in Mozambique. Bulletin of Insectology 70 (1): 45-48. http://www.bulletinofinsectology.org/pdfarticles/vol70-2017-045-048bila.pdf
BOSCO D.; TEDESCHI R. 2013. Insect vector transmission assays. En: Dickinson, M.; Hodgetts, J. (Eds.). Phytoplasma. Methods in molecular biology (Methods and Protocols). Vol. 938. Humana Press, Totowa, NJ. 421 p. https://doi.org/10.1007/978-1-62703-089-2_7
BOSCO, D.; D’AMELIO, R.; WEINTRAUB, P. G.; JONES, P. 2009. Transmission specificity and competition of multiple phytoplasmas in the insect vector. pp. 293-308. En: Weintraub, P. G.; Jones, P. (Eds.). Phytoplasmas: genomes, plant hosts and vectors. CABI. Wallingford, Reino Unido. 352 p. https://doi.org/10.1079/9781845935306.0293
BRESSAN, A.; CLAIR, D.; SÉMÉTEY, O.; BOUDON-PADIEU, E. 2006. Insect injection and artificial feeding bioassays to test the vector specificity of Flavescence dorée phytoplasma. Phytopathology 96 (7): 790-796. https://doi.org/10.1094/PHYTO-96-0790
BROWN, S. E.; BEEN, B. O.; McLAUGHLIN, W. A. 2006. Detection and variability of the lethal yellowing group (16Sr IV) phytoplasmas in the Cedusa sp. (Hemiptera: Auchenorrhyncha: Derbidae) in Jamaica. Annals of Applied Biology 149 (1): 53-62. https://doi.org/10.1111/j.1744-7348.2006.00072.x
BROWN, S. E.; BEEN, B. O.; McLAUGHLIN, W. A. 2007. The lethal yellowing (16SrIV) group of phytoplasmas. Pest Technology 1 (1): 61-69. http://www.globalsciencebooks.info/Online/GSBOnline/images/0706/PT_1(1)/PT_1(1)61-69o.pdf
CHRISTENSEN, N. M.; NYSKJOLD, H.; NICOLAISEN, M. 2013. Real-time PCR for universal phytoplasma detection and quantification. pp. 245-252. En: Dickinson M.; Hodgetts, J. (Eds.). Phytoplasma. Methods in molecular biology (Methods and Protocols). Vol. 938. Humana Press, Totowa, NJ. 421 p. https://doi.org/10.1007/978-1-62703-089-2_21
CÓRDOVA, I.; OROPEZA, C.; ALMEYDA, H.; HARRISON, N. A. 2000. First report of a phytoplasma-associated leaf yellowing syndrome of Palma Jipi plants in Southern Mexico. Plant Disease 84 (7): 807-807. https://doi.org/10.1094/PDIS.2000.84.7.807A
CÓRDOVA, I.; OROPEZA, C.; PUCH-HAU, C.; HARRISON, N.; COLLÍ-RODRÍGUEZ, A.; NARVÁEZ, M.; NIC-MATOS, G.; REYES, C.; SÁENZ, L. 2014. A real-time PCR assay for detection of coconut lethal yellowing phytoplasmas of group 16SrIV subgroups A, D and E found in the Americas. Journal of Plant Pathology 96 (2): 343-352. http://doi.org/10.4454/JPP.V96I2.031
DAVIS, R. E.; LEE, I. M. 1993. Cluster-specific polymerase chain reaction amplification of 16S rDNA sequences for detection and identification of Mycoplasmalike Organisms. Phytopathology 83 (9): 1008-1011. https://doi.org/10.1094/Phyto-83-1008
DERY, K. S.; MARIAU, D.; PHILIPPE, R. 1996. Auchenorrhyncha (Homoptera), suspected vectors of coconut lethal yellowing disease in Ghana. Plantations, Recherche, Développement 3 (5): 355-363.
DICKINSON, M.; TUFFEN, M.; HODGETTS, J. 2013. The Phytoplasmas: An introduction. En: Dickinson, M.; Hodgetts, J. (Eds.). Phytoplasma. Methods in molecular biology (Methods and Protocols). Vol. 938. Humana Press, Totowa, NJ. 421 p. https://doi.org/10.1007/978-1-62703-089-2_1
DOLLET, M.; LLAUGER, R.; FABRE, S.; JULIA, J. F.; GONZALEZ, C.; CUETO, J. R. 2010. Nymphocixia caribbea (Fennah) (Homoptera: Cixiidae) potential candidate as coconut lethal yellowing vector in the Carribean. En: COST Action FA0807. Current status and perspectives of phytoplasma disease research and management, Sitges, Espagne, 1-02 February 2010. Disponible en: https://agritrop.cirad.fr/555468/ [Fecha revisión: 31 julio 2018].
DOLLET, M.; MACOME, F.; VAZ, A.; FABRE, S. 2011. Phytoplasmas identical to coconut lethal yellowing phytoplasmas from Zambesia (Mozambique) found in a pentatomide bug in Cabo Delgado province. Bulletin of Insectology 64 (Supplement): S139-S140. Disponible en: https://agritrop.cirad.fr/562170/ [Fecha revisión: 6 agosto 2018].
EDEN-GREEN, S. 1979. Attempts to transmit lethal yellowing disease of coconuts [Cocos nucifera L.] in Jamaica by leaf hoppers (Homoptera: Cicadelloidea). Tropical Agriculture (Trinidad y Tobago) 56 (3): 185-192.
EDWIN, B. T.; MOHANKUMAR, C. 2007. Molecular identificación of Proutista moesta as the vector and the phylogenetic analysis of KWD in India. Indian Journal of Biotechnology 6: 560-563. http://nopr.niscair.res.in/bitstream/123456789/3086/1/IJBT%206%284%29%20560-563.pdf
GALETTO, L.; PEGORARO, M.; MARZACHÌ, C.; ROSSI, E.; LUCCHI, A.; BOSCO, D. 2019. Potential role of the alien planthopper Ricania speculum as vector of Flavescence dorée phytoplasma. European Journal of Plant Pathology 154 (4): 1103-1110. https://doi.org/10.1007/s10658-019-01731-0
HARRISON, N.; RICHARDSON, P.; TSAI, J. H.; EBBERT, M.; KRAMER, J. P. 1996. PCR assay for detection of the phytoplasma associated with maize bushy stunt disease. Plant Disease 80 (3): 263-269. https://doi.org/10.1094/PD-80-0263
HARRISON, N. A.; WOMACK, M.; CARPIO, M. L. 2002. Detection and characterization of a lethal yellowing (16SrIV) group phytoplasma in Canary Island date palms affected by lethal decline in Texas. Plant Disease 86 (6): 676-681. https://doi.org/10.1094/PDIS.2002.86.6.676
HARRISON, N.; HELMICK, E.; ELLIOTT, M. 2008. Lethal yellowing‐type diseases of palms associated with phytoplasmas newly identified in Florida, USA. Annals of Applied Biology 153 (1): 85-94. https://doi.org/10.1111/j.1744-7348.2008.00240.x
HOGENHOUT, S. A.; OSHIMA, K.; AMMAR, E. D.; KAKIZAWA, S.; KINGDOM, H. N.; NAMBA, S. 2008. Phytoplasmas: bacteria that manipulate plants and insects. Molecular Plant Pathology 9 (4): 403-423. https://doi.org/10.1111/j.1364-3703.2008.00472.x
HOWARD, F. W. 1986. Myndus crudus (Homoptera: Cixiidae), a vector of lethal yellowing of palms. pp. 117-129. En: Wilson, M. R.; Nault, L. R. (Eds.). Proceedings of 2nd International Workshop on Leafhoppers and Planthoppers of Economic Importance. Brigham Young University, Provo, Utah, EE. UU.
HOWARD, F. W. 2001. Sap-feeders on palms. pp. 109- 232. En: Howard, F. W.; Moore, D.; Giblin-Davis, R. M.; Abad, R. G. (Eds.). Insects on palms. CABI Publishing. Wallingford, Reino Unido, 403 p. https://doi.org/10.1079/9780851993263.0109
HOWARD, F. W.; NORRIS, R. C.; THOMAS, D. L. 1983. Evidence of transmission of palm lethal yellowing agent by a planthopper, Myndus crudus (Homoptera, Cixiidae). Tropical Agriculture 60 (3): 168-171.
JARAUSCH, W.; FUCHS, A.; JARAUSCH, B. 2010. Establishment of a quantitative real-time PCR assay for the specific quantification of ‘Ca. Phytoplasma prunorum’ in plants and insects. Julius-Kühn-Archiv 427: 392-394. https://ojs.openagrar.de/index.php/JKA/article/view/623
KRAMER, J. P. 1977. Taxonomic study of the planthopper genus Oecleus in the United States (Homoptera: Fulgoroidea: Cixiidae). Transactions of the American Entomological Society 103 (2): 379-449. Disponible en: https://www.jstor.org/stable/25078207 [Fecha revisión: 6 agosto 2018].
KRAMER, J. P. 1979. Taxonomic study of the planthopper genus Myndus in the Americas (Homoptera: Fulgoroidea: Cixiidae). Transactions of the American Entomological Society 105 (3): 301-389. https://www.jstor.org/stable/25078242
KWADJO, K. E.; BEUGRÉ, N. D. I.; DIETRICH, C. H.; THIERRY KODJO, A. T.; ATTA DIALLO, H.; YANKEY, N.; DERY, S.; WILSON, M.; KONAN KONAN, J. N.; CONTALDO, N.; PALTRINIERI, S.; BERTACCINI, A.; AROCHA ROSETE, Y. 2018. Identification of Nedotepa curta Dmitriev as a potential vector of the Côte d’Ivoire lethal yellowing phytoplasma in coconut palms sole or in mixed infection with a ‘Candidatus Phytoplasma asteris’-related strain. Crop Protection 110: 48-56. https://doi.org/10.1016/j.cropro.2017.12.015
LEE, I. M.; DAVIS, R. E.; GUNDERSEN-RINDAL, D. E. 2000. Phytoplasma: Phytopathogenic Mollicutes. Annual Reviews in Microbiology 54 (1): 221-255. https://doi.org/10.1146/annurev.micro.54.1.221
LIU, J.; GOPURENKO, D.; FLETCHER, M. J.; JOHNSON, A. C.; GURR, G. M. 2017. Phytoplasmas–The “Crouching Tiger” Threat of Australian Plant Pathology. Frontiers in Plant Science 26: 599. https://doi.org/10.3389/fpls.2017.00599
LU, H.; WILSON, B. A. L.; ASH, G. J.; WORUBA, S. B.; FLETCHER, M. J.; YOU, M.; YANG, G.; GURR, G. M. 2016. Determining putative vectors of the Bogia coconut syndrome phytoplasma using loop-mediated isothermal amplification of single-insect feeding media. Scientific Reports 6 (1): 35801. https://doi.org/10.1038/srep35801
MARTÍNEZ, R. T.; NARVÁEZ, M.; FABRE, S.; HARRISON, N.; OROPEZA, C.; DOLLET, M.; HICHEZ, E. 2008. Coconut lethal yellowing on the southern coast of the Dominican Republic is associated with a new 16SrIV group phytoplasma. Plant pathology 57 (2): 366-366. https://doi.org/10.1111/j.1365-3059.2007.01726.x
MPUNAMI, A.; TYMON, A.; JONES, P.; DICKINSON, M. J. 2001. Identification of potential vectors of the coconut lethal disease phytoplasma. Plant Pathology 49 (3): 355-361. https://doi.org/10.1046/j.1365-3059.2000.00460.x
MYRIE, W.; HARRISON, N.; DOLLET, M.; BEEN, B. 2007. Molecular detection and characterization of phytoplasmas associated with lethal yellowing disease of coconut palms in Jamaica. Bulletin of Insectology 60 (2): 159-160. http://www.bulletinofinsectology.org/pdfarticles/vol60-2007-159-160myrie.pdf
MYRIE, W.; OROPEZA, C.; SAENZ, L.; HARRISON, N.; ROCA, M. M.; CÓRDOVA, I.; KU, S.; DOUGLAS, L. 2011. Reliable improved molecular detection of coconut lethal yellowing phytoplasma and reduction of associated disease through field management strategies. Bulletin of Insectology 64: S203-S204. http://www.bulletinofinsectology.org/pdfarticles/vol64-2011-S203-S204myrie.pdf
NARVÁEZ, M.; VÁZQUEZ-EUÁN, R.; HARRISON, N. A.; NIC-MATOS, G.; JULIA, J. F.; DZIDO, J. L.; FABRE, S.; DOLLET, M.; OROPEZA, C. 2018. Presence of 16SrIV phytoplasmas of subgroups A, D and E in planthopper Haplaxius crudus Van Duzee insects in Yucatán, Mexico. 3 Biotech 8: 61. https://doi.org/10.1007/s13205-018-1094-5
POWELL, C. M.; HAIL, D.; POTOCNJAK, J.; HANSON, J. D.; HALBERT, S. H.; BEXTINE, B. R. 2015. Bacterial community composition of three candidate insect vectors of palm phytoplasma (Texas Phoenix Palm Decline and Lethal Yellowing). Current Microbiology 70: 240-245. https://doi.org/10.1007/s00284-014-0709-2
RASHIDI, M.; D'AMELIO, R.; GALETTO, L.; MARZACHÌ, C.; BOSCO, D. 2014. Interactive transmission of two phytoplasmas by the vector insect. Annals of Applied Biology 165 (3): 404-413. https://doi.org/10.1111/aab.12146
REINERT, J. A. 1977. Field biology and control of Haplaxius crudus on St. Augustinegrass and Christmas palm. Journal of Economic Entomology 70 (1): 54-56. https://doi.org/10.1093/jee/70.1.54
SFORZA, R.; BOURGOIN, T.; WILSON, S. W.; BOUDON-PADIEU, E. 1999. Field observations, laboratory rearing and descriptions of immatures of the planthopper Hyalesthes obsoletus (Hemiptera: Cixiidae). European Journal of Entomology 96 (4): 409-418. https://www.eje.cz/artkey/eje-199904-0015_Field_observations_laboratory_rearing_and_descriptions_of_immatures_of_the_planthopper_Hyalesthes_obsoletus_H.php
SMART, C. D.; SCHNEIDER, B.; BLOMQUIST, C. L.; GUERRA, L. J.; HARRISON, N. A.; AHRENS, U.; LORENZ, K. H.; SEEMÜLLER, E.; KIRKPATRICK, B. C. 1996. Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region. Applied and Environmental Microbiology 62 (8): 2988-2993. https://doi.org/10.1128/AEM.62.8.2988-2993.1996
THOMAS, D.; NORRIS, R. 1980. The use of electron microscopy for lethal yellowing diagnosis [Cocos nucifera]. Proceedings of the annual meeting of the Florida State Horticultural Society, EE. UU. 93: 196-199.
TSAI, J. H.; KIRSCH, O. H. 1978. Bionomics of Haplaxius crudus (Homoptera: Cixiidae). Environmental Entomology 7 (2): 305-308. https://doi.org/10.1093/ee/7.2.305
TSAI, J. H.; WOODIEL, N. L.; KIRSCH, O. H. 1976. Rearing tecniques for Haplaxius crudus (Homoptera: Cixiidae). Florida Entomologist 59 (1): 41-43. https://doi.org/10.2307/3493167
TYMON, A. M.; JONES, P.; HARRISON, N. A. 1997. Detection and differentiation of African coconut phytoplasmas: RFLP analysis of PCR-amplified 16S rDNA and DNA hybridisation. Annals of Applied Biology 131 (1): 91-102. https://doi.org/10.1111/j.1744-7348.1997.tb05398.x
TYMON, A. M.; JONES, P.; HARRISON, N. A. 1998. Phylogenetic relationships of coconut phytoplasmas and the development of specific oligonucleotide PCR primers. Annals of Applied Biology 132 (3): 437-452. https://doi.org/10.1111/j.1744-7348.1998.tb05220.x
VÁZQUEZ-EUÁN, R. C. 2010. Detección y caracterización de fitoplasmas del grupo del amarillamiento letal en diferentes especies de palmeras en Yucatán. Tesis de Doctorado en Ciencias y Biotecnología de Plantas. Centro de Investigación Científica de Yucatán. Mérida, Yucatán, México. 75 p. Disponible en: http://cicy.repositorioinstitucional.mx/jspui/handle/1003/596 [Fecha revisión: 6 agosto 2018].
VÁZQUEZ-EUÁN, R.; HARRISON, N.; NARVÁEZ, M.; OROPEZA, C. 2011. Occurrence of a 16SrIV group phytoplasma not previously associated with palm species in Yucatan, Mexico. Plant Disease 95 (3): 256-262. https://doi.org/10.1094/PDIS-02-10-0150
WEINTRAUB, P. G. 2007. Insect vectors of phytoplasmas and their control–an update. Bulletin of Insectology 60 (2): 169-173. http://www.bulletinofinsectology.org/pdfarticles/vol60-2007-169-173weintraub.pdf
WEINTRAUB, P. G.; BEANLAND, L. 2006. Insect vectors of phytoplasmas. Annual Review of Entomology 51: 91-111. https://doi.org/10.1146/annurev.ento.51.110104.151039
WILSON, S. W. 2005. Keys to the families of Fulgoromorpha with emphasis on planthoppers of potential economic importance in the southeastern United States (Hemiptera: Auchenorrhyncha). Florida Entomologist 88 (4): 464-481. https://doi.org/10.1653/0015-4040(2005)88[464:KTTFOF]2.0.CO;2
Descargas
Aceptado 2020-07-15
Publicado 2020-07-15
Esta obra está bajo una licencia internacional Creative Commons Atribución-NoComercial-CompartirIgual 4.0.
Los autores conservan los derechos patrimoniales sobre su trabajo y son responsables de las ideas emitidas en ellos. Una vez un manuscrito sea aprobado para publicar se solicita a los autores una licencia de publicación por el término de la protección legal, para todos los territorios que permite el uso, difusión y divulgación de los mismos.